Use LEFT and RIGHT arrow keys to navigate between flashcards;
Use UP and DOWN arrow keys to flip the card;
H to show hint;
A reads text to speech;
10 Cards in this Set
- Front
- Back
Most restriction sites are _______ base pairs long.
|
4 to 6
|
|
Which of the following enzymes would a bacterium most likely use to prevent its DNA from
being chopped up by its own restriction enzymes? |
Methylase
|
|
Which of the following is a palindromic recognition sequence?
A) 5´. . . GTATAC . . . 3´ B) 5´. . . GTAATG . . . 3´ C) 5´. . . CATTAC . . . 3´ D) 5´. . . GATTAC . . . 3´ E) 5´. . . GTAGTA . . . 3´ |
*** A) 5´. . . GTATAC . . . 3´
|
|
DNA is _______ charged due to the presence of a _______ group.
|
negatively; phosphate
|
|
A RFLP
|
is a restriction fragment length polymorphism.
is inherited in a Mendelian fashion. can be used as a genetic marker. can be useful to help define a discrete allele of a gene. |
|
In what way does a ddNTP differ from its dNTP counterparts?
|
The ddNTP is missing an —OH group.
|
|
In DNA sequencing, ddNTPs are added at much lower concentrations than are dNTPs. If
ddNTPs were added at higher concentrations, what would be the most likely result? |
All of the reactions would terminate early and long strands would not be produced.
|
|
The fluorescent dye attached to ddNTPs in DNA sequencing
|
aids in visualization of the DNA strand when the ddNTP is incorporated.
|
|
The
following DNA molecules form a double-‐stranded region. 5' ATATGGGCCATAGC 3' 3' GCGCTAGCCTACACTTCCTATACCCGGTATCGTCTTCTTTCCATTTGGGCTCTAACCA 5' They are added to a reaction mixture containing DNA polymerase and dGTP, dCTP, dATP and ddTTP. What is the expected product of the reaction? |
5' ATATGGGCCATAGCAGAAGAAAGGT 3'
3' GCGCTAGCCTACACTTCCTATACCCGGTATCGTCTTCTTTCCATTTGGGCTCTAACCA 5' |
|
In order to make a gene on a plasmid for expression of a human protein in bacteria, you have
to |
insert a cDNA sequence into the plasmid so that the open reading frame is not disrupted by
introns use a promoter in the plasmid that can be expressed in E. coli make sure that the 5' UTR contains a Shine-Dalgarno sequence make sure that the plasmid is ligated back into a circle before transformation |